EST details — SGN-E246828

Search information 
Request: 246828Match: SGN-E246828
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26864Clone name: cLEF-41-M7
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C180499 is on microarray TOM1: SGN-S1-1-8.1.19.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180499 [TUS-34-I9] Trace: SGN-T193494 EST: SGN-E392168 Direction: 3' Facility: INRA
Clone: SGN-C180499 [TUS-34-I9] Trace: SGN-T193495 EST: SGN-E392169 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246828Length: 575 bp (913 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246828 [] (trimmed) GAGATTAACCAAAATCTCTTTCTCCTCATGAGATGGTGGGTCTCAGTGTAGTACTCGAAGGTTGCAATAATAAAGATATCAATACAATAAATGCT
TCTTCTACTTGGCAAATTCTTAACAAAGCTAGTATGGTATTGATGAAACCCACTTCTCCTTTTTCCACCCCAAAATCTCCCGAACCTTCTGGGTT
TCTCGATTCCTGTTTCCTTTGTAAACAGAAACTCTTACCTGGAAAAGACATCTACATGTACAAGGGAGAATGGGCATTTTGTAGCGTAGAGTGCA
GGTGCAAGCAGATTTTTATGGATGAAGAAGAGAGTATGAAAACGAAATCTAAAGCTTCCATTAAATCGTGTACTTCTTCTTCTTCATCATCATCG
TCGTCTTACCGGAGTAGGAAAACGGCGGCGAGGAACCGACCGAATGCGTTTGCATACTGAGAAAGGAGTTGGGTTGGACGAAAATTTCCAGTTTT
GTCCTCGATACATTTTGTAATGACTATGGTATCCGTTTTCATTTTGAATTTTGTGAAATTATTAATATTAGTAGTACGGAAAAAAACAAAAAACT
GCTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246828] SGN-U574964 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60243 [Download] [View] Facility Assigned ID: TMGGE76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0089 Quality Trim Threshold: 14.5