EST details — SGN-E246885

Search information 
Request: 246885Match: SGN-E246885
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26708Clone name: cLEF-41-F17
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176420 is on microarray TOM1: SGN-S1-1-7.3.10.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176420 [TUS-23-O10] Trace: SGN-T181175 EST: SGN-E369137 Direction: 3' Facility: INRA
Clone: SGN-C176420 [TUS-23-O10] Trace: SGN-T181176 EST: SGN-E369138 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246885Length: 500 bp (944 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E246885 [] (trimmed) GAAAAAATGATTCGGAAGATGAGTCGAGTTCTGATGAATCTGAATCTGATTTTTACTCTGCATCTGAAGACTTGGCAGAAGCCCCTACTAAAGAT
GATGAGATCTTGGGGCTTTCTTCTGAAGACTCGGAAGATGATGACTATAATCCTGATGATCCAGATAAGGATGAGCCGGTTAAAACAGAAAGTTC
AAGTTCTGATTTTACGTCCGACTCTGAGGATTTTAGTCTGATAGTTGATACTAATAGGTTGCGAGGTGATGAACAAGGGGTTTCCAGCTCAGTAG
ATAACAGTATGCCAAACTCGGTTTCCCTAAAGGAAAAAGCTAAAGTTGGCAAAGCTAAAGGGAATTCGCTGAAGGATGAGTTGTCTTATCTTATG
CAGTCTGATAGCCCTCTTGTCTCTGCCAAAAGGCACATAGAGAGGTTGGACTACAAAAAGCTGCACGATGAAACATATGGAAATGGGTCTTCTGA
TTCTAGTGATGAAGATTATGATGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246885] SGN-U576071 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60300 [Download] [View] Facility Assigned ID: TMGGG33TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.961 Expected Error Rate: 0.0106 Quality Trim Threshold: 14.5