Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E246929

Search information 
Request: 246929Match: SGN-E246929
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26761Clone name: cLEF-41-H8
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176441 is on microarray TOM1: SGN-S1-1-2.4.11.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E246929Length: 572 bp (894 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E246929 [] (trimmed) GAGAGAACTAGACTCGAGTTAATTTTTTTATTTTTTCCCGATTGTCTAGGGTTTTTGACAATAGTATATAAACACTGTTGCATAGAGATTCACCA
AACTCTCTCGTATTCATTACAATGGCTTTTTCTTCTCTTCTCAAACCTGCCGCCTCCTTTGTTCGACCTTCACATCGATCTCAGGTATCATGTGC
AGGACTTCATCATAGTAGTAATTCTGTTAAATTACAATCGTCTATCTTCGGAGATGCTGTGACAATTTTGCAATCTTCGTCTTTACAAAAATCTG
GTGCCTGCAGTATTCAACCTATCAGAGCAACTGCTACTGAGCTGCCTCCAACAGTTCCAAGGTCACAAACTGGTGGGAAGACAAGGGTTGGCATC
AATGGTTTTGGACGTATTGGGAGATTGGTATTACGAATTGCAACATTCAGGGATGATATTGAAGTGGTCGCAGTTAATGACCCATTTATCGATGC
AAAGTATATGGCTTACATGCTCAAGTATGATTCCACTCATGGAGTCTACAGTGGATCCATCAGTGTCCTGGATGACTCTACTTTGGAAATCAATG
GG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E246929] SGN-U564569 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60344 [Download] [View] Facility Assigned ID: TMGGH40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.964 Expected Error Rate: 0.0134 Quality Trim Threshold: 14.5