EST details — SGN-E247055

Search information 
Request: 247055Match: SGN-E247055
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C26754Clone name: cLEF-41-H23
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176437 is on microarray TOM1: SGN-S1-1-6.4.11.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176437 [TUS-23-P3] Trace: SGN-T181330 EST: SGN-E368403 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247055Length: 510 bp (972 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247055 [] (trimmed) ACACCACCGTCTAATTTGTAAATATATTCGCCGGAAACTTCTCTATCCACGCTTTCTCTATATCTATCATACCCTTTTTCTTAATTAATCGGTTG
CTATTCCTTTGATGGCAGCGATTACGCAGAGAAAAGATTCGGATCGGATCAAAGGTCCATGGAGTCCTGAAGAGGACGAGTTGTTGCAGACGCTT
GTTGAGAAACATGGACCTAGAAACTGGACTTTGATAAGCAAATCGGTGCCGGGTCGATCTGGTAAATCCTGTCGTCTCCGGTGGTGTAATCAGCT
TTCACCTCAAGTGGAACATCGTGCTTTTACTCCTGAAGAAGATGATACGATCATCAGGGCTCATGCCAAGTTTGGTAATAAATGGGCGACTATTG
CCCGTTTGTTATCGGGTCGGACTGATAACGCTATAAAGAACCATTGGAACTCTACTCTTAAACGTAAGTGTCCTTCCATGTCCGAAGATTTAAGC
TTTGAAACCCCTCAACCGCCTTTGAAAAGATCGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247055] SGN-U582039 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T60470 [Download] [View] Facility Assigned ID: TMGGG48TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.984 Expected Error Rate: 0.0071 Quality Trim Threshold: 14.5