EST details — SGN-E247267

Search information 
Request: 247267Match: SGN-E247267
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28231Clone name: cLEF-46-P22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176941 is on microarray TOM1: SGN-S1-1-6.1.8.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176941 [TUS-25-E3] Trace: SGN-T181654 EST: SGN-E369792 Direction: 3' Facility: INRA
Clone: SGN-C176941 [TUS-25-E3] Trace: SGN-T181655 EST: SGN-E369793 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247267Length: 547 bp (934 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247267 [] (trimmed) GAATAGCTGGTTGTGGGAAGTTGGAGGTATCAAAATTCTTGTGTGATCCAATCTTGGTGGGTAACTTGGATTTTGGAATTCCTTGGTTATATGAT
GCTGCCAAAAAATTTGTCAAGAATTTCCAGCTTGATGACCTTCCACTAATACACTGCTTACTCATCACGCAAAGCCTTGATGATCATTGTCATCT
CAACACATTAAAGCCTCTCTCCCGCAAGTTCCCAAACCTTACTGTTATAGCTACTCCAAATGCTAAGACACTGCTCGATCCTCTGTTCACCAATG
TCATCTACTTGGAACCTGGACAGGATTCCGCGATTGAAGTGAGTAATGGGTTCCAGGTTAAAATTAAGGCTACGGCAGGGCCAGTTCTTGGACCT
CCTTGGCAGCGACCTGAGAATGGATATCTTGTCACTTCTCCAAAAGGTGCTCTTACTCTCTACTATGAACCTCACTGTGTCTATGACAAGAGCAC
CTTAGAGAAACACAGGGCAGATATTGTTATCACTCCTGTCATAAAGCAACTTCTACCAAATTTTACATTGGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247267] SGN-U574999 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61678 [Download] [View] Facility Assigned ID: TMGHB95TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0161 Quality Trim Threshold: 14.5