EST details — SGN-E247301

Search information 
Request: 247301Match: SGN-E247301
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28172Clone name: cLEF-46-M22
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176919 is on microarray TOM1: SGN-S1-1-4.4.8.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176919 [TUS-25-D5] Trace: SGN-T181959 EST: SGN-E369006 Direction: 3' Facility: INRA
Clone: SGN-C176919 [TUS-25-D5] Trace: SGN-T181960 EST: SGN-E369007 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247301Length: 568 bp (1022 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247301 [] (trimmed) GAGAAACTGAGACTCCAGTGGTGAGTGAGGACACCATCAATGTGTTGGACGATGTTCAAGTATTTGATCTGAATGGACAAGGAGTACCTATTTCG
GATTTGTGGAAAGATAGGAAGGCAGTTGTTGCCTTTGCTCGTCATTTTGGATGCGTCCTTTGTCGCATAAGAGCTGATTATCTTGCAGCTGAGAA
GGATAAGATGGATGCAGCAGGAGTCGCACTTGTTTTGATTGGACCTGGTAGTGTTGATCAGGCCAGAAAATTCTACGAGCAAACAAAGTTTAAAG
GAGAGGTTTATGCTGATCCAAGCTATAGGTCTTATGAGGCTCTGAGATTTGTGTCTGGCATTACAACCACATTTACTCCCGGGGCGGGTCTGAAA
ATAATACAGGCATACATGGAAGGCTATAGACAAGATTGGGAGCTTTCTTTCGAAAAGGACACCAGGACACGAGGTGGCTGGCGACAAGGAGGAAT
TATTGTTGCAGGTCCTGGTAAAAATAACATTACATACATTCACAAGGACAAAGAAGCAGGTGATGATCCAGATATAAAAGAAATCTTGAATGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247301] SGN-U564340 Tomato 200607 Build 2 14 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61712 [Download] [View] Facility Assigned ID: TMGGZ83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0051 Quality Trim Threshold: 14.5