EST details — SGN-E247378

Search information 
Request: 247378Match: SGN-E247378
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28045Clone name: cLEF-46-G16
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176864 is on microarray TOM1: SGN-S1-1-3.1.8.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176864 [TUS-25-A22] Trace: SGN-T181722 EST: SGN-E369230 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247378Length: 588 bp (996 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247378 [] (trimmed) CCTTTTTCTCACACTTTTCATCTCAACACAAGCGAAGTCAGCAGATATGAATCCAGGGGGTTATACAGTAGAAGTTACAGGTCTTTCCCCTGCTG
CTACTGAGAAGGATGTTCAGGAGTTCTTTGCTTTCTGTGGGGCAATTGAACATGTTGAGATTGTCAGAGCTGGTGAACATGCAAGTACAGCCTAT
GTGACGTTTAGAAATCCTCATGCATTGGAAACGGCTGTCTTACTGAGTGGGGCTGCCATTTTGGATCAACGTGTGTGCATAACCAGCTGGGGCCA
CTATCAAGATGATTTTGATTATTGGAATCATTCATCATGGAAACCTCAAGAAGACTGTCATTCAAGTGACTCCCAAGGACACCATTTTGTTTCTT
CTGCTGGGGAAGCTGTAACATTGACTCAAGATGTGGTTAAAACCATGCTATCTCAAGGGTATGTTCTTGGTAAAGGCGCATTGGGAAAAGCCAAA
GCTTTTGACGAATCTCATGGGCTGTCAGCAACTGCAGTCTCCAAGGTTGCTGATTTAAGTGAGAGAATCGGCCTCACTGACAAGTTCTGTGCCGG
GGTTGAAGTGGCTAGGTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247378] SGN-U574607 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61789 [Download] [View] Facility Assigned ID: TMGGZ44TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.969 Expected Error Rate: 0.0067 Quality Trim Threshold: 14.5