Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E247379

Search information 
Request: 247379Match: SGN-E247379
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28080Clone name: cLEF-46-I10
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176878 is on microarray TOM1: SGN-S1-1-5.2.8.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176878 [TUS-25-B12] Trace: SGN-T182026 EST: SGN-E369537 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247379Length: 392 bp (1039 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E247379 [] (trimmed) ATACACCGTTTTCGGCAGGAGAGCAATTCCCCCTACAAACAAAGTCATCATGCCTGCACTTGTTGTAACTGAAGAAACAATGGCCTCCGAGCTAT
CCAAGAAAAAAATGAAGAAGACACCCAAAACTGATATTGAAACTCCTACTGATAAGAAAACCAAAGAGAAAAAGTCAAAAAAATCCAAGATTGAG
TCTGGGTCTGATTCAGAGGACGCTAAAAGGAGTCAAAAGAAAGAGAAAAAGAGAAAAGCTTTGGACTTGGATGGTGAGAAGAGTGATACGAGCTC
AGAGATATGCGAGCCCGTAGATTTGAAGAAGAATAAAAAGGCTAAATTCGACGACGAACAAGTGATGGTTGAGAAGAAAGTCGAGGATCCTAATG
CTTTGCCTAATT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247379] SGN-U577438 Tomato 200607 Build 2 18 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61790 [Download] [View] Facility Assigned ID: TMGGZ53TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.931 Expected Error Rate: 0.0073 Quality Trim Threshold: 14.5