EST details — SGN-E247385

Search information 
Request: 247385Match: SGN-E247385
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28168Clone name: cLEF-46-M18
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C176917 is on microarray TOM1: SGN-S1-1-6.4.8.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C176917 [TUS-25-D3] Trace: SGN-T181879 EST: SGN-E368926 Direction: 3' Facility: INRA
Clone: SGN-C176917 [TUS-25-D3] Trace: SGN-T181880 EST: SGN-E368927 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E247385Length: 538 bp (1010 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E247385 [] (trimmed) TTCATTATCGTGGTTGCACCCCATGGAGAAGCGCTAAGTTGCGGCCAGGTTGAATCTGCCTTACCTCCCTGCCTTCCTTATCTTTAGGGAAAAGG
CCCTCTAGGAGGGTGTTGTCGTGGAGTTAAGGGTCTATTGGGCGCAGCCAAGACCCCCGCGGATCGAAAGACAGCATGCACTTGCCTCAAATCAG
CTGCTAATGCTATTAAAGGCCTTAATCTAGGCAAAGCCGCTGGTATACCTAGTGCTTGTGGCGTAAGCATTCCTTACAAGATCAGCCCTTTTACT
GACTGCTCGAAGGTTCAGTAAGGTTGATGAAAGTTCAATTTTCCAAGGCATAATTGGGGAAAAATAAGACGGATATATCTATCGATCGATCGAGT
TTAATCCATCATTTTATAATATGTTGTCTCTTTTATTTTGTATTTTTGTTTGTTGGAGTACTTATATGTTGTCCAGTATTGTAATGAACTTTTGT
GGTTGGGTGTATTACAACCCAATCTTCATAGTAATTTATATACATCATATTTTACTTTTTTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E247385] SGN-U579687 Tomato 200607 Build 2 127 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T61796 [Download] [View] Facility Assigned ID: TMGGZ81TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0138 Quality Trim Threshold: 12.5