EST details — SGN-E248384

Search information 
Request: 248384Match: SGN-E248384
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32472Clone name: cLEG-1-O1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183461 is on microarray TOM1: SGN-S1-1-6.4.1.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248384Length: 571 bp (878 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248384 [] (trimmed) TCAACCAATGGGTGAAAAAATCAAAGTTGAAGGAGCAGAGAAGAAGAACGAAAGTTCAATTGTTTTAAAACTGGATTTGCATTGTGAAGGTTGTG
CACAAAAACTCAGACGATTCATTCGCCATACTCATGGTGTGGAAAAAGTGAAATCGGATTGTGAAACTGGAAAACTGACGGTTAAAGGTGACGTT
GACCCTTCATGGCTCCGGGAGAGAGTGGAGATCAAAACCAAAAAGAAGGTGGAGCTTATATCATCGCCGCCCAAAAAGGACGCCGGAGATAAAAA
GAGCGGCGGAGATAAAAAGTCCGGTGAAAAAACAGAGGACAAGAAGGAAGACGAGAAGAAACCCAAAGAGGCTCAAGTAATCAGTGTGGTGGCAT
TAAAGATTCGGGTGCATTGTGATGGATGTGCACATAAAATCAAACGAGTTATTAAAAAGATTAAAGGGGTACAAGAAGTGAATATAGAATCAGAA
AAAGATTTGGCCACGGTAAAGGGGTCAATGGATATAAAGAAGTTAACTCCTTATTTGATTGATAAATTGAAGCAAAATGTTGAAGTGGTTCCATC
T
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248384] SGN-U579681 Tomato 200607 Build 2 27 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64447 [Download] [View] Facility Assigned ID: TBFAA85TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.940 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5