EST details — SGN-E248828

Search information 
Request: 248828Match: SGN-E248828
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28835Clone name: cLEF-49-G1
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177005 is on microarray TOM1: SGN-S1-1-6.3.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177005 [TUS-25-G19] Trace: SGN-T181671 EST: SGN-E369809 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248828Length: 571 bp (846 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248828 [] (trimmed) CTTCTCTGGCATCTCCACTATGTACATGGCTCGTAGCAGCTTGCATGTCTGTATCCAGCGAAAAGGATCAATTTTCGAAGCCTGCTTCTAGCTTT
CAGTCTTCCAAGTTCATGGGTAGGAGAAGAAAAGCGATTACCAAGTTCAAAAGTGGGAGCTTGATGAATGGTTCTGTAATGAACACTTCTTGGCA
TAATTGTTTTGGTTTTGAGCCCTGTGAGGAGTATTATAAATCAGACGGATTCTCTGCTTCTTTTTCGTCTTTATTTGCCGAAAATCCGTTTTCTG
TATTTGGGTTTAAACAGGTGCCATTGAATCGAAGGCAGAGGAGAATGAGCTCTGCTGCTCATCCTGGCAAACCCATGGCTGTGGCTGTGCAACCT
GCAATGGAAGCCACGACAATGAAGAAACCTCTTATGAGGAACAGGAGAGTTGTTGTGACCGGGGTCGGTGTAGTATCACCAATTGGTCATGATCC
AGACATGTTTTATAGTAATCTTCTTGAAGGCATCAGTGGTATAAGTCAGATTGAGGCTTTCGACTGTTCTGAATTTCCCAGTAGAATTGCTGGGG
A
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248828] SGN-U567962 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62336 [Download] [View] Facility Assigned ID: TMGHK37TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.983 Expected Error Rate: 0.0022 Quality Trim Threshold: 14.5