Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E248831

Search information 
Request: 248831Match: SGN-E248831
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28856Clone name: cLEF-49-G7
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177022 is on microarray TOM1: SGN-S1-1-5.4.8.6
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177022 [TUS-25-H12] Trace: SGN-T182134 EST: SGN-E369645 Direction: 3' Facility: INRA
Clone: SGN-C177022 [TUS-25-H12] Trace: SGN-T182135 EST: SGN-E369646 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248831Length: 597 bp (848 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248831 [] (trimmed) CTTTCTGAAAGGTACTCATCAATGTGTAGATTGTTCAATTACCAGGAGCTTTGTTCAGCAACATCTGATTTCCTGCCAGAGAATTTGATTGGAAA
AGGAGGCAGCAGTCAGGTTTACAAAGGGTGCCTTCCAGATGGCAAGCAACTGGCTGTGAAAATATTGAAGCCATCAGAAGCTGTGGCCCAGCAAT
TCCGGTCAGAGATAGAGATACTCACAACTCTGCATCACAAGCACATTATATCACTGTTTGGTTTTTGCTTGGAGGAGAACAACCTTTTACTGGTT
TATGATCTATTATCCAGAGGAAGCTTAGAAGAGAATCTCCATGGTTCCAAAAAGGATGAAAATACATTTAGCTGGGTAGATAGATACAAAGTCGC
TTTGGGTGTTGCTGAGGCACTGGACCACCTACACAATGCAGCTGATGGGCCCATAATCCACAGGGATGTGAAATCTTCAAACATTCTCCTGTCCG
ATGATTCTGAGCCACAGCTTTCAGATTTTGGACTTGCAACACCAGCCTCAAGCTGTTCAAATCATTTAGATAGCATTGATGTTGCTGGAACTTTT
GGCTACTTGGCTCCTGAGTACTTTATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248831] SGN-U563034 Tomato 200607 Build 2 5 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62339 [Download] [View] Facility Assigned ID: TMGHK40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.965 Expected Error Rate: 0.0066 Quality Trim Threshold: 14.5