EST details — SGN-E248846

Search information 
Request: 248846Match: SGN-E248846
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28944Clone name: cLEF-49-K9
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177076 is on microarray TOM1: SGN-S1-1-7.2.8.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248846Length: 553 bp (850 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E248846 [] (trimmed) ACCAACCGACGCTCCATTATTTTGAGAAGAAGCCTTTCTTCTTCATCATCAATTTTCAGCTCATTCCTCTGCACCTTCCTTTTTTTTTTGTATTG
TAATATACACATATTGCGTTTTATTTTTGTTGATTAGATATTGATATTCAGAGATCGAATTGCTCTGCTATTGTAATTTTTTTTTGAAAAAAATA
TGGATGAATTTGGCGTTTTGGTTGAGAGATATGGCGTCAAAGTTCAAGGAGGCAAGTCAACGCCCATGGCTAATTTGAAGGCGAAAAACAATTCC
AGCAATGGTTTTCCGTCGAATCTCGGGTTTAATTCGGGTCAAAACACCGGGTATAGCTCTGGGGATCCATTTGCGGATGATCTCGATGGAATTTT
CAGGTCTAAGGCTTCGCCGAACTACGATGATAATGATATTTTTGGAGGTGTGTTTGCAAATTCAAAGCAGCAGCAGAATAATGTGGATATTGAAT
CAGTATTGGGAGGTTCGAGTTCGGGTAATAATAATAACTATGCTAGTNAGAATGTGAATGATGATTTTGATTTGTTTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248846] SGN-U576934 Tomato 200607 Build 2 31 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62354 [Download] [View] Facility Assigned ID: TMGHK65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.956 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5