EST details — SGN-E248947

Search information 
Request: 248947Match: SGN-E248947
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C28832Clone name: cLEF-49-F6
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: Alias clone SGN-C177003 is on microarray TOM1: SGN-S1-1-8.3.8.10
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177003 [TUS-25-G17] Trace: SGN-T181669 EST: SGN-E369807 Direction: 3' Facility: INRA
Clone: SGN-C177003 [TUS-25-G17] Trace: SGN-T181670 EST: SGN-E369808 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E248947Length: 514 bp (1032 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E248947 [] (trimmed) ACGGGACAAGCATTATATCATTAAAAAAGAAAAACTGAACTGCCGAGAGAGAGAGTGTGTAGAGTATTGACATTCATTAACTGATCCTTTAAACT
GAGCTATTTCCTGTGACATTCACCTTCAACCAAAAGCCAATGGCCGAACGGAGAACATCCCCTACTATTTTAACTATGGAGAAAAAATGATAAAA
ATGAAGAAAAAAACATAGAACAAAGTTTAGGAATCTCTCTAAAAGAGTAAGAGGTGTGCCATCATAAAGAGATGTGGACTAAAACCTATACTGAT
AAGATACACAAAAAGAATGTCACTGACAGAATACAGTAGGTTTCATCTTTGAACTTGGTCAGCAGCATGGTTGTTAGCCGTCGAAGAGGAGGCCA
CCCTGCCATTTAACATCCCATTATCAACAGGTGGACTTACGCCCCACTTCCCTTCAGATTCCAGTGGTTCAATCACTTTAACAGTTCCATCTGTC
AACCCAACTGCAAATTGGCTGGGTTCTTGTGGATGTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E248947] SGN-U566564 Tomato 200607 Build 2 20 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62455 [Download] [View] Facility Assigned ID: TMGHN27TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0136 Quality Trim Threshold: 14.5