EST details — SGN-E249376

Search information 
Request: 249376Match: SGN-E249376
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C29341Clone name: cLEF-50-O24
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249376Length: 291 bp (989 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249376 [] (trimmed) TTTTTTAAAAATGAATTCTCAACACCAACGAGCCAAACATAAGATGCACACTACTTTTTAAAAAACACAAATTTCCAATGAAACCCAATGCAATA
TTTTCTCAAAAAAAAAAAACACAAACAAATTAAACATGAATTGCCAACTACAACAATTCAAACATAAAATGCATAATAATTAAAACAACACGAAT
TTCACACGAAACTTATTAGAAAAGTTGGTTGCTGAAGCGGAAATTCGCAATTAGCATATCAAACACCGCAATAACTCTTGAGAAGATCACTTGGA
GGAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249376] SGN-U580211 Tomato 200607 Build 2 38 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T62884 [Download] [View] Facility Assigned ID: TMGHP96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.882 Expected Error Rate: 0.0098 Quality Trim Threshold: 14.5