EST details — SGN-E249473

Search information 
Request: 249473Match: SGN-E249473
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C30051Clone name: cLEF-56-E14
cartOrder Clone
Library Name: cLEFOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: mature green

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249473Length: 555 bp (768 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249473 [] (trimmed) AATGCCAGAAGAGGGGGAGAGGCTGTGGCTTATTGATGCAGTTGTCCCTTCCAAAGAGTTGTTAAAAGTAGCTAGACAGTGGGCCCTTGATATTG
CAGAAAGGCGCAAACCTTGGATGCGTGCCCTTCACAGGACTGACAAAATTGGTTCCCTTTCAGAAGCACATGAAGTTCTGCAGTTGGCTAGGAAA
CAAGTGAAGCAAACTGCTCGGAATATGCCTCACCACTTGGCATGCCTTGATGTAATTGAAGAAGGCATAGTCCATGGTGGATATAATGGGATTCT
CAAGGAAGCTAAAGTTTTTGAGGACCTTGTATTATCAGATACATCAAGAGGTCTTGTTCACGTATTTTTTGCCCAACGGGCTACATCAAAGGTAC
CTAATGTAACTGATATTGGTCTGAAACCAAGGTCAGTGAAGAAAGTTGCCATAATAGGTGGAGGTTTAATGGGTTCAGGCATAGCAACCTCTCTT
GTTCTGAGCAACATATTTGTTATTATCAAGGAAATTAATCCTGAGTATCTTCAGAAGGGGATAAAAACAGTTGAAGCAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249473] SGN-U565750 Tomato 200607 Build 2 12 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T63602 [Download] [View] Facility Assigned ID: TMGIN31TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0094 Quality Trim Threshold: 20.5