EST details — SGN-E249937

Search information 
Request: 249937Match: SGN-E249937
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C39477Clone name: cLEG-4-E21
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E249937Length: 426 bp (1023 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E249937 [] (trimmed) GTACGGTCTGCTATTTTGGCTACTCCATCTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTTTGAGGCAGGCAGCCTTGGT
GAAGAGGCAACTGAGATCTACCAATGAGTTAGAAGTGAAGCCGGATATACCTATTCCGGGGAATTTGGGCTTGTTGAGTGAAGCATATGATAGGT
GTGGTGAAGTATGTGCAGAGTATGCAAAGACGTTTAACTTAGGAACTATGCTAATGACTCCCGAGAGAAGAAGGGCTATCTGGGCAATATATGTA
TGGTGCAGAAGAACAGATGAACTTGTTGATGGCCCAAACGCATCATATATTACCCCGGCAGCCTTAGATAGGTGGGAAAATAGGCTAGAAGATGT
TTTCAATGGGCGGCCATTTGACATGCTCGATGGTGCTTTGTCCGAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E249937] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64551 [Download] [View] Facility Assigned ID: TBFAM35TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.975 Expected Error Rate: 0.0032 Quality Trim Threshold: 14.5