EST details — SGN-E250395

Search information 
Request: 250395Match: SGN-E250395
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C44713Clone name: cLEG-6-O6
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250395Length: 385 bp (922 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250395 [] (trimmed) GCCACTTTACACTCTGCTGGTAACAGAATAACTGCTATGAGTAAGAGTCGAACAGTGAAAGGAGTTGGTTGGGATATTGCTGCTTTAGGAAATGC
TGTTTGGGGTGGAGCCAAATTGGCAGATGTTCTAGAATTAGTTGGAATACCTTATTTGGCAAGTATCACACAATCTGGAGGAAAACATGTGGAAT
TTGTGAGCATTGACAAGTGTAAGGAGGAAAATGGAGGTCCTTATAAGGCATCAATTCCATTGAGTCAGGCTACAAACCCTGAAGCTGATGTTCTG
CTCGCTTTTAATTTTCTCCAGAATGGAGAGCCACTTAATAGGGATCATGGCTATTCACTGCGTGTGGTTGTCCCTGGTGTGATAGGTGCCCGTTC
AGCTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250395] SGN-U581608 Tomato 200607 Build 2 70 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T64982 [Download] [View] Facility Assigned ID: TBFAV87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.944 Expected Error Rate: 0.0053 Quality Trim Threshold: 20.5