Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E250458

Search information 
Request: 250458Match: SGN-E250458
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32330Clone name: cLEG-18-K15
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180629 is on microarray TOM1: SGN-S1-1-6.2.19.15
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180629 [TUS-34-N19] Trace: SGN-T187101 EST: SGN-E375199 Direction: 3' Facility: INRA
Clone: SGN-C180629 [TUS-34-N19] Trace: SGN-T187102 EST: SGN-E375200 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250458Length: 683 bp (843 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E250458 [] (trimmed) GAACTACCACGCCGAATTTGCATTGACTTCTCTTCGTCTCCGGCACTGTTTTTACGAGAATCCATGGGTACTTCCGACGTTAATGCTAACTCCTC
CTCCTCTTCCCTCGTCAAAGATTTCCTCCACAAATGCGGTGGCGTTGCCGTGATTGACGGCGGATTTGCGACGGAGCTGGAGCGTCATGGAGCCG
ACCTTAATGACCCTCTTTGGAGCGCTAAATGTCTCCTCACTGACCCTCACCTTGTCCGCGCTGTACACTTGGATTACCTTGAAGCTGGTGCAGAT
ATAATACTCAGTTCATCTTATCAGGCAACCATCCAGGGGTTTAAGGCCAAAGGATATTCTATAGAAGAAAGTGAATCCTTACTCAAAAGAAGTGT
TGAGATTGCATGTGAAGCACGTGATGTCTACTATAAAAGATGCCGTGAATCTTCCTCTGATCAAAGCACTGATGGGAAGGTTCTCAAACAACGCC
CTATCTTAGTTGCAGCATCTGTTGGGAGTTATGGGGCCTATTTAGCTGACGGTTCAGAATACAGTGGGGAATATGGGGATGCGGTTGATCTCAAG
TTTCTAAAGGATTTTCATCGTAGAAGGGTTCATCTTCTTGCAAACTCTGGTGCTGATCTAATAGCTTTTGAGACCGTGCCAAATAAACTGGAAGC
TCAGGCTTTTGTCGAGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250458] SGN-U582642 Tomato 200607 Build 2 17 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67232 [Download] [View] Facility Assigned ID: TBFCQ68TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.987 Expected Error Rate: 0.0074 Quality Trim Threshold: 14.5