Notice: Due to a regional power outage, SGN was briefly unavailable on Saturday, Feb 4. We apologize for the inconvenience.

EST details — SGN-E250656

Search information 
Request: 250656Match: SGN-E250656
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C45486Clone name: cLEG-7-P23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180333 is on microarray TOM1: SGN-S1-1-6.2.19.8
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180333 [TUS-34-B11] Trace: SGN-T187116 EST: SGN-E375214 Direction: 3' Facility: INRA
Clone: SGN-C180333 [TUS-34-B11] Trace: SGN-T187117 EST: SGN-E375215 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250656Length: 406 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E250656 [] (trimmed) GGATCCCCCCGGCTGCACGGTTAGCAGAAATTTTCAACATGAACAGAACGAGGATCTCTTGCTTTTAAGAATAAGCCTCCACATTCGGCTGAGAG
AGTTTCTGAATCTCCATCATCTATACAACAGCCAAAAACCGTTAAAAAGAGGAGATACATTCCCCAATCTTCGGAGAGGACCCTGGATGCTCCTG
ACATCCTAGATGACTTTTATCTCAATTTGTTAGACTGGGGAAGCAATAACGTAATTGCCATTGCCTTAAGAAATTCTGTATATCTATGGGATGCT
TCTGATGGGTCTGTTACCTGAGCTTCTCACGGTTGATGATGATTTTGGGCCGGTGACTGCTGTCAGCTGGTCACCAGATGGAAGAAGCCTTGCAG
TGGGCTTGAATAATTCACACGTTCAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250656] SGN-U571433 Tomato 200607 Build 2 11 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T65103 [Download] [View] Facility Assigned ID: TBFBA96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.977 Expected Error Rate: 0.0122 Quality Trim Threshold: 14.5