EST details — SGN-E250903

Search information 
Request: 250903Match: SGN-E250903
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31352Clone name: cLEG-13-C4
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E250903Length: 527 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E250903 [] (trimmed) AGTTCACTTGTTGATGATATCTTTTTGATTGTAAAAAAGAAGATTAAGTATGGCTGATGAATACGAACAGAACGGGGCATCCGTTGAAGAGACTG
TTGGTACCAACGTGGAAGCTACTGATCGTGGTTTGTTTGATTTCATTGGAAAAAAAGAAGAGGAAAAACCAAGTCATGCTCATGAAGAAGAGGCA
ATTTCATCTGAGTTGTGTGAAAAAGTTAACGTAAGTGAAGAAGTGGAACCCAAGGAAGAGGAAAAGAAACTTCATCGATCAAATAGCAGCTCTAG
TAGCTCCAGTGATGAGGAGGAAGAAATTGGAGAGGATGGACAGAAGATCAAGAAGAAGAAAAAGAAGGGATTGAAGGATAATATTAAGGAAAAAA
TATCTGGTGATCACAAGGAAGAATCGAAAGCTGAGGATACCTCAGTTCCAGTTGAGAAATACGAGGAAACATATGAGAAAAAAGGATTTCTAGAC
AAAATTAAGGAGAAATTGCCAGGTGGCGGGCATAAGAAGACTGAGGAAGTGG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E250903] SGN-U581375 Tomato 200607 Build 2 231 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66382 [Download] [View] Facility Assigned ID: TBFBX14TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.919 Expected Error Rate: 0.0222 Quality Trim Threshold: 14.5