EST details — SGN-E250935
Search information |
Request: 250935 | Match: SGN-E250935 |
Request From: SGN database generated link | Match Type: EST sequence internal identifier |
Clone information |
SGN ID: SGN-C31494 | Clone name: cLEG-13-O8 |
| ||
Library Name: cLEG | Organism: Solanum lycopersicum (formerly Lycopersicon esculentum) |
Tissue: fruit pericarp
Development Stage: breaker fruit
Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing |
No additional reads found.[Show information hierarchy]
Sequence |
Sequence Id: SGN-E250935 | Length: 158 bp (893 bp untrimmed) |
Status: Current Version | Direction: 5' |
>SGN-E250935 [] (trimmed)
ACATGAAATTACTACTTCATTGGCATGGTTTATTTCTTTCTCTATACTGCCACATGAAATGCTGGCCTGCGTTCGATCGCATGGTCCTGCTACTA
TGATTCCTCTATTTCATCACAACCTTTCTGAATTAGAAGCAGCCGGAAAGCTACTGCACTCTT
TGATTCCTCTATTTCATCACAACCTTTCTGAATTAGAAGCAGCCGGAAAGCTACTGCACTCTT
Unigenes |
Current Unigene builds | |||||
[SGN-E250935] | SGN-U573743 | Tomato 200607 | Build 2 | 19 ESTs assembled | |
Follow SGN-U# link for detailed information and annotations |
Chromatogram |
SGN-ID: SGN-T66414 [Download] [View] | Facility Assigned ID: TBFBX88TH |
Submitter: Koni | Sequencing Facility: TIGR |
Quality processing |
Processed By: SGN | Basecalling Software: phred |
Passed all screens and filters
Sequence Entropy: 0.000 | Expected Error Rate: 0.0035 | Quality Trim Threshold: 20.5 |