EST details — SGN-E251798

Search information 
Request: 251798Match: SGN-E251798
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31854Clone name: cLEG-15-P22
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E251798Length: 533 bp (913 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E251798 [] (trimmed) GTGAAATCTGCTATTGAAGCCGAGGCTGACTCCCAGCAGAAGCTAGGTGCTGCAGAAGCTGAGATTGCTGAGCTGAGACAGAAGTTAGATGCTCC
TAAAAGGGAACGGTCTAGACTCTCGGAAGTCTTGAAGTCTAAGCATGAAGAAACCGAGGCCTACCTCTCTGAGATTGAGACAATTGGGCAGGCCT
ACGATGATATGCAAGCTCAAAATCAGCAGCTTTTCCAGCAAATCACAGAGAGAGATGATTACAATATAAAGCTTGTTTTAGAAGGAGTACGGGCA
AGACAACAGCGGGATTGTTTGGCTTGGGAAAGTCAAATCACAGAGAGAGCAGTTGAAGATGCCAATACAATGGTCAGTTCCTATGAAATGAAAGC
TGCCAAAATTGATGACCAGTTGAGGGGATGCTCAGACTTGATCCAGAAGCTTGCTGAAGATAGGGGTCAGAATTCTCTTGCTTTAGAGAACACCC
AAAAACGGTTTTTAGATGTAAGAAAATCTTCCCAGCAATTGCGGGAGACGCTGGAAGA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E251798] SGN-U565040 Tomato 200607 Build 2 10 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66812 [Download] [View] Facility Assigned ID: TBFCH95THB
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.960 Expected Error Rate: 0.0127 Quality Trim Threshold: 14.5