EST details — SGN-E252308

Search information 
Request: 252308Match: SGN-E252308
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31312Clone name: cLEG-12-P5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185112 is on microarray TOM1: SGN-S1-1-3.1.12.19
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185112 [TUS-46-I14] Trace: SGN-T199001 EST: SGN-E397675 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252308Length: 560 bp (995 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252308 [] (trimmed) GCTTGAGCCAATTGAAGAAGTGACTATTGAGGTTGATGACGAGCACGTAGGTGTGGTCATGGAAGCACTTTCTCACAGGCGAGGTGAAGTTACTG
ACATGGGCCCTGTTCCTGGCAGCATGGGAAGGACTAGAATGTGTCTGACATGTCCTTCAAGAGGGCTAGTGGGCTATAGAAGCGTGTTCAGCAGT
GACACCCGTGGCTCTGGATTTATGCATCGAGCTTTTCTGACTTATGAAAAATATCGTGGTCCTCTTGGAAATGTCAGGAAAGGAGTTCTAGTATC
AATGGGCCGTGGGTTAATCACTGCTCATGCACTGATGGGGTTAGAACCTCGTGGAGTTCTCTTTGTGGCACCTGCAATGGAGACATATGATGGCA
TGATTATTGGAGAACATTCTCGGGATACAGATCTTGATGTCAATCCGGTTAAGGCAAAAGAACTCAACAATATAAGGTGCGCTAGCAAGGATGAG
AACGTCAAGTTAACTCCTCCCCGCCTTATGTCCCTCGAAGAAGCCATAGGATATGTTGCTTCCGATGAGCTTATTGAGGTTACAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252308] SGN-U580723 Tomato 200607 Build 2 24 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66118 [Download] [View] Facility Assigned ID: TBFBU87TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.985 Expected Error Rate: 0.0074 Quality Trim Threshold: 12.5