Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E252365

Search information 
Request: 252365Match: SGN-E252365
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31235Clone name: cLEG-12-K9
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180479 is on microarray TOM1: SGN-S1-1-4.4.19.9
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252365Length: 472 bp (883 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252365 [] (trimmed) AATTAAAAATATTTATATTTAATCAAATTTTTAAAACAGTAAAGGGGGGCAAAATGGTAATACAACAATTCATTTTCGAACTTCCCCATATAATA
ATATATGAAATATGATAACAGACAAACAAATCTAGCATAAGGCAGTATTTAGCTTCAAAATAAGAGATCAAGCACGATCATCTTGTTGTTTAAAC
ATTATCCACTGAAGCAAGCGCTGCTGGTGTTGCTGGTGCAGCTGAAGCTATGGTAAACTGTACACTTCTCGGCTGTCCAGAGTGTAACACAACTG
CAAATTGTGTTGCTGCCAATGCTGCAGCTTCCTCTCTTTGTCTGCGCTGCTGCAAGATGCTGATGGCCCAAAGCATGATGTAGCAGGGTAAAAGA
AAGCCAACTGCCCGGAGTAAGAAAAGCGAAAAGAAAGCAGTTGGATCTTCATCATCTCCATCTGTATCTGTCATTGGTAATGCATGGCGCAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252365] SGN-U573343 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T66175 [Download] [View] Facility Assigned ID: TBFBS65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0106 Quality Trim Threshold: 12.5