EST details — SGN-E252471

Search information 
Request: 252471Match: SGN-E252471
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32550Clone name: cLEG-20-E7
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182356 is on microarray TOM1: SGN-S1-1-7.2.7.1
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C182356 [TUS-39-F18] Trace: SGN-T191538 EST: SGN-E390212 Direction: 5' Facility: INRA
Clone: SGN-C182356 [TUS-39-F18] Trace: SGN-T191761 EST: SGN-E390435 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252471Length: 513 bp (983 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E252471 [] (trimmed) CCCAATTCTTATTGTTCATTCAATACCTTACAACTTAGATATTTTTCTCCATCTGAAGTTCCCAATTATACTAGTTGACACATGGGATTGAGATT
GGGGTTAATCTTTGTTGATAAAGTTAGAGTCTTTAAGCCAAAACAAGTTGAATCAGTATGGAATCACAACTGGGTTTAATTGAAAAATCATTTAA
TGTTAAATACTCAGATGGGGTTAGAGAAGCTCTTGATGAATTGCCTGATAGTTTTACAATTACTGATCCCTCTATTTCTGGTCACCCTATTGTTT
ATGTATCAAGGGGTTTCTTGAAAGTATTTGGTTATTCAAAGAATGAGGTTTTAGGGAAGAATGGAAGGGTATTTCAAGGGCCTAAGACTAATAGA
AGATCAGTTATGGCGATTCGAGAGGCGATTCGTGAGGAGAGGGGTATACAGATTAGTTTGTTGAATTATAGGAAGGATGGGACACCCTTTTGGAT
GTTGTTTAATATGTGTCCTGTTTATAGTGAGAAGGATG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252471] SGN-U568979 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67321 [Download] [View] Facility Assigned ID: TBFCY28TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0017 Quality Trim Threshold: 20.5