EST details — SGN-E252541

Search information 
Request: 252541Match: SGN-E252541
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32581Clone name: cLEG-20-H6
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252541Length: 153 bp (1062 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252541 [] (trimmed) GATTAAAGACAATCAACAAAATCACAGGGTGTCTCCTATTTTGATTTCAGATGGGAGTGCAGATGGGCATGGCAAGAAGGACAAAATGATCGACT
TGAATGTAAAGCCAAGTCGTTTTCATGGTCAGGCATCTAATCAAGATTAACTCATCTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252541] SGN-U582207 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67391 [Download] [View] Facility Assigned ID: TBFDB39TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.893 Expected Error Rate: 0.0020 Quality Trim Threshold: 20.5