EST details — SGN-E252560

Search information 
Request: 252560Match: SGN-E252560
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32495Clone name: cLEG-20-A13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188098 [TUS-54-E24] Trace: SGN-T351781 EST: SGN-E550906 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252560Length: 242 bp (986 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252560 [] (trimmed) CGTTTGACCTTCTTGGGGCTCACTGCAAACCAGACCCCAATGATTAAATCTTCATCTTCAATCTGCTTTTTACCTGCCACTTCAAATCAACATTC
TTGATTTTCATAATCAGATCCAAAATTTCATAATATTCGAATCAAAGACTGAAACTTTATTGTATCAATCTGGATCCCTTCGAATCAAGATTCTT
GATTCCCACAAACATATCAAAGATTCACCATATTTGACTCCAAGACTGAAAC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252560] SGN-U574214 Tomato 200607 Build 2 8 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67410 [Download] [View] Facility Assigned ID: TBFCY07TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.849 Expected Error Rate: 0.0176 Quality Trim Threshold: 20.5