EST details — SGN-E252857

Search information 
Request: 252857Match: SGN-E252857
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32056Clone name: cLEG-16-M14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180585 is on microarray TOM1: SGN-S1-1-2.4.19.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180585 [TUS-34-L23] Trace: SGN-T187176 EST: SGN-E375274 Direction: 3' Facility: INRA
Clone: SGN-C180585 [TUS-34-L23] Trace: SGN-T187177 EST: SGN-E375275 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252857Length: 627 bp (932 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E252857 [] (trimmed) TGTTATATACAGGGGGTGGAGTTAGAGGGTAAGTTACGCATTTAGTCGTAACTTTAGTCAAACTTCGTAATAATTTAAAATTCAGAGTGGCCATT
GTTGAAAGAGAGGGTGGAATTTGTAAGTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTTATAAT
CTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATAAACTA
AGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCCTTGTT
ATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCATAGGA
ATTTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATTTTCTGTACGGTCTGCTATTTTGGCTACTCCA
TCTGGAGAACGGACGATGACATCGGAACAGATGGTCTATGATGTGGTTTTGAGGCAN
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252857] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67013 [Download] [View] Facility Assigned ID: TBFCJ79TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0017 Quality Trim Threshold: 14.5