EST details — SGN-E252892

Search information 
Request: 252892Match: SGN-E252892
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C31984Clone name: cLEG-16-H4
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188079 [TUS-54-E5] Trace: SGN-T351783 EST: SGN-E550908 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E252892Length: 568 bp (930 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E252892 [] (trimmed) AATATCAAAGACCGTTACTATGGAGTCAATGATCCAGTGGCTTTAAAGCTACTTAATAAAGCAGGTGAAATGCCTTCATTGGAGCCCCCTGATGA
CGAGAGCATTAGAACCCTCTATGTGGGTGGTGTTGATGCAAGAATCACTGAGCAGGACCTTAGGGACCATTTTTATGCACATGGTGAAATTGAGT
CCATTAAAATGGTGGTCCAGCGTGGTTGTGCTTTTGTAACTTACACGACTAGAGAAGGTGCGGTGAAGGCAGCTGAGGAACTTGCAAACAAGCTG
GTGATAAAGGGCCTGAGACTGAAGCTACTCTGGGGGAGACCTCAAGTTCCCAAGCCAGAGTCCGAGGTCTCTGATGAAGCAAGACAGCAGGCTGC
TCTAACTCACAGTGGTTTGTTGCCTAGAGCAGTCGTATCACAGCAGCAGAATCAGCCTCTTCAGCCACCAGGCACTCAGGACCAACCTCCATCCA
TGCCTTACTTCAACATACCCCCGATGCCTCAGCAAGACAGACCATATTATCCATCAATGGATCCACAAAGGATGGGTGCCGTAATTGCATCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E252892] SGN-U579399 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67048 [Download] [View] Facility Assigned ID: TBFCL38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.979 Expected Error Rate: 0.0021 Quality Trim Threshold: 14.5