Notice: The SGN server will be upgraded later today. SGN may be intermittently unavailable during the upgrade. We apologize for any inconvenience.

EST details — SGN-E253533

Search information 
Request: 253533Match: SGN-E253533
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C32974Clone name: cLEG-24-M22
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C185122 is on microarray TOM1: SGN-S1-1-1.1.11.2
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C185122 [TUS-46-I24] Trace: SGN-T196590 EST: SGN-E395264 Direction: 5' Facility: INRA
Clone: SGN-C185122 [TUS-46-I24] Trace: SGN-T199005 EST: SGN-E397679 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E253533Length: 585 bp (952 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E253533 [] (trimmed) AGCTAAATTCTCCATTTTTCTTCCTTATTTTTTTTACAAATTTTATTCATGGCATCCACTGGGCACACCAATCTGAATGCAAAACTTGTATTGTT
AGGTGACATGGGAGCTGGTAAATCAAGCTTGGTTATACGATTCATAAAGGGCCAATTCCTTGAATTTCAAGAATCGACGATTGGGGCGGCTTTCT
TTTCGTCTACATTGGCAGTTAATAATGCTACGGTGAAGTTTGAGATATGGGATACTGCTGGGCAGGAGAGGTACCATAGCTTAGCACCTATGTAT
TATAGAGGCGCTGCAGCTGCTATTATTGTCTATGATATCACTAGCTCGGATTCATTTGCAAAGGCAAAGAAATGGGTGCAAGAATTGCAGAAGCA
AGGTAATTCTAACATGATCATGGCTCTTGCTGGCAATAAGGCAGATCTAGAAGATCGAAGGAACGTTCCTGCAGAAGAGGCACGCTTGTATGCAG
AGGAAAATGGCCTCTTTTTCATGGAGACCTCTGCCAAAACTGCTGCGAATGTCAATGATATTTTCTATGAAATAGCTAAACGGTTGCCTACAGCT
CAACCCACTCAAAAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E253533] SGN-U578324 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T67781 [Download] [View] Facility Assigned ID: TBFDP83TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0159 Quality Trim Threshold: 14.5