EST details — SGN-E254081

Search information 
Request: 254081Match: SGN-E254081
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35329Clone name: cLEG-34-H7
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C183135 is on microarray TOM1: SGN-S1-1-4.3.3.5
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C183135 [TUS-41-G5] Trace: SGN-T191699 EST: SGN-E390373 Direction: 3' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254081Length: 519 bp (891 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E254081 [] (trimmed) AAATGTGAGCCTGATAAGAGTCCAAATGGCAACAAAGAGGCTGAGGCGAAATTCAAACAGATATCTGAAGCTTATGAGGTTTTGAGTGATTCACA
GAAAAGGGCAATTTATGATCAGTATGGGGAAGAAGGCCTTAAAGGTCAAGTGCCACCACCAGATGCTGCTGCTGGTGGACCTGGTGGGGCTACAT
ATTTCCATACAGGTGATGGACCAAATGTGTTCAGATTCAATCCAAGAAATGCCAATGATATCTTTGCAGAATTTTTTGGGTTTCAAACCCCGTTT
GGCGGTGGTGGGATGGGAGGCGGCGGCGGTGGTGGGATGAGAGGTGCAAGGTTTTCTAGTTCAATGTTTGGAGATGATATCTTCAGTTCATTTGG
AGAAGGCAGACCAACCATACGGAAGGCGCCACCGATTGAACGAACAGTCCCTTGTAGTCTAGAAGAACTTTATTGTGGGACAACCCAAGAAGATG
AAGATCTCTACGGAGATTGCTGATGCAAGTGGGAAGACTTTACC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254081] SGN-U573688 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70139 [Download] [View] Facility Assigned ID: TBFFE40TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0199 Quality Trim Threshold: 14.5