EST details — SGN-E254146

Search information 
Request: 254146Match: SGN-E254146
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35430Clone name: cLEG-34-O7
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180833 is on microarray TOM1: SGN-S1-1-2.3.17.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254146Length: 576 bp (904 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E254146 [] (trimmed) AGCAAACTTTATCTATATTGCTGATATTTACATTACAAAAAAAGATTCAAACTCATTGCCAAAATCCCAAAAAAACCTACCTACTATATTGCTAA
TGAAAGAAAAAAAGATTTAAGGCAAAGCATTGGCCAAGCCTACTTCTTGATATCTGCCAAGTAAATTGGCTGCAATTAGACTCACATCCTCTAAA
CCAACCCCAATACATAGAGAGTTACTTGTAGTTGGAGCAGAGCTAACAGCAACCGAGTCACCGGCTTGGAAGGCGTCCGAGATGCTGCTGCTGCT
ACACCCTGAAACTTTGACATTAGGACCAACTTTACACTTTCCCATGCATTTGCAACCAGAGACTGCAGCTTCAATCCCAGCAACGCGTTGGAATT
CTTCTAGTAACGCTCCAGCGCCCAATCGCTTGCATTTACCACCCATACATACTTCGATTCTCTTTGTACCCTCTGCTGTTGTCGTTGTAGCTGCT
GCTATAGATGATACATTAGACCTAGTGCCTGGTGTGATACTGCTGCCTACATTGCCAATGTGACAATCACTAGCTTCCAAGCAGCATTTCCCTTT
TTGTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254146] SGN-U579250 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70204 [Download] [View] Facility Assigned ID: TBFFC88TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.972 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5