EST details — SGN-E254273

Search information 
Request: 254273Match: SGN-E254273
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C33659Clone name: cLEG-27-K24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254273Length: 618 bp (944 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E254273 [] (trimmed) CTTCCATGAATTTTCTAACTATTAAATTACGTGTTGTATTCATTTTCTTCTTAACAATTCAAATCCGCCATTTCTGTGTAGCTCAAAAAGCTTGT
TACTAAAATGGCGAATTCCGGTCCTCTGAACCCAAACCCGGTTCCGAACTCCGATCGTCTCGAACAACTGAAACAATTCGATGAGTCGAAAATTG
GAGTTAAAGGGCTTGTTGATAAGGGCCTTACTACTATACCCAGTTTCTTCATCCACTCAGAAGAATCAAACCCGGAACCCAAAACCCGATCAAGT
AACAATCACTGCATACCCGTCGTCGACTTTTCTGCTTCTCGGGAAACAGTCGTTGAACAAGTTCATCGTGCTTCAACGAGCTTAGGGTTCTTCCA
GATTATCAACCATTCTGTTCCGGTCAGTGCTATAAATAGAATTGTAGGTTCGATTAAATCGTTTAACGAACAGAATAATGAATTGAAGATGAAGT
ATTATAGTAGGGATATTACTCATGGAGCAGCGTATTCTACGAATTTTGATTTGTATAACTCGAAAGCTGCAAGCTGGAGGGATACGTTGCAGGTG
AGATTGTCGCCTACTCCACCGGATTGGGAGTATGTGCCNGAGGTGTGT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254273] SGN-U570114 Tomato 200607 Build 2 22 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68349 [Download] [View] Facility Assigned ID: TBFEB72TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.989 Expected Error Rate: 0.0162 Quality Trim Threshold: 14.5