EST details — SGN-E254496

Search information 
Request: 254496Match: SGN-E254496
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34050Clone name: cLEG-29-I11
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E254496Length: 264 bp (1019 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E254496 [] (trimmed) AGGCCGGGGCCCCCCCATGGTAGTGAACCACTGCATACCATAAAATCTGATGAAGTCAGTGATAGATTGCACTCATGAATTACTCAATTTACCAG
AGGAAGAAAAACACAAGTTTACTGGGAAGCATGTGTTGGATCCTATAAGATATGGGACAAGTTTCAATACTAATACAGAAAATGTCTTCTTTTGG
AGAGATTTTCTCAAGGACTTTGTCCATCCTCATTTTCACTCTACCACCAAACCACAAACCTACAGGGGTATTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E254496] SGN-U579869 Tomato 200607 Build 2 86 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T68762 [Download] [View] Facility Assigned ID: TBFEI54TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.939 Expected Error Rate: 0.0170 Quality Trim Threshold: 20.5