EST details — SGN-E255017

Search information 
Request: 255017Match: SGN-E255017
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34515Clone name: cLEG-31-C23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180695 is on microarray TOM1: SGN-S1-1-4.1.17.14
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180695 [TUS-35-A13] Trace: SGN-T187453 EST: SGN-E375685 Direction: 3' Facility: INRA
Clone: SGN-C180695 [TUS-35-A13] Trace: SGN-T187454 EST: SGN-E375686 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255017Length: 577 bp (969 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255017 [] (trimmed) GAACTTAAAAAGCATAACATATTAAAACCGTCTCAACATCTTATCTGGGAATTCGCTATAAAAACCAGAAAGTAGAAAGGCATCAGAGATGCTTT
TGTCACAGCTCATCAAGCAACTTGGATCAAACCAAATTGCTCAATAACTCCACTATCCTCAAAAGAGGCTAGAGAACCATGACAAAAGCTTCTGG
AGCCAAATCTATGACTGGTAAAATGTTCAAAACAAAATTGAAAATAGCTAATGCAATTAAACAAAACTAGGAAAGGCGTGACAGAATTGAGCTCA
GCTAGTAGATTCCCTGTATGGGCATCTTTGGTCTTGTACCGCAAAATACTAGATGAGATTGAAGCCAATGACTACAACAACTTCACAAAGAGAGC
ATATGTGAGCAAATCAAAGAAGTTGATTGCATTACCTATTGCATATGCAAAATCTCTTGTGCCTCCTACAAAAACTGCCTCTCTTCAAAGATAAA
GCATGAAATGAAGATATATATATATATATATATAGCAATATACATTAGAAGAAAAAAAGGAAGAAGAAATGTTGTTGTATTGATATAAATGTATA
TCATAAA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255017] SGN-U578676 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69310 [Download] [View] Facility Assigned ID: TBFEQ24TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.942 Expected Error Rate: 0.0237 Quality Trim Threshold: 12.5