EST details — SGN-E255131

Search information 
Request: 255131Match: SGN-E255131
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34729Clone name: cLEG-31-P20
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255131Length: 213 bp (898 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255131 [] (trimmed) AGCGCAAGATAAAGTAATCACTACTGTTGACAAAGTATGTGTCCTTAGTTGTGGAATTTCGACAGGCCTTGGAGCAAGTTTGAATGTTGCTAAAC
CAACAAAAGGCTCAAGTGTGGCTATATTTGGACTAGGAGCTGTAGGCCTCGCGGCTGCAGAAGGAGCCAGAATTGCTGGTGCCCTNCCCCGCGGA
TAATTGGTGTTGATTTAAATGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255131] SGN-U579420 Tomato 200607 Build 2 345 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69424 [Download] [View] Facility Assigned ID: TBFET94TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.995 Expected Error Rate: 0.0516 Quality Trim Threshold: 14.5