EST details — SGN-E255357

Search information 
Request: 255357Match: SGN-E255357
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34189Clone name: cLEG-30-B1
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177149 is on microarray TOM1: SGN-S1-1-6.1.8.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255357Length: 539 bp (838 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255357 [] (trimmed) AAAAATCCCACTTTTTAAAACCCCAAATTCATAAATTTTTCGAAATCCCAAATCTTTTTTTTCACTCTTTCTATGCTCTAACAAAAAAAAAAGAC
ATCTTTTTTGGTATAATACACCAAAATGTTGGTTCTTGGAAATTCCTTTGTGATATTTACATTTGTTTTGTGTTCTATATGTGTATTTACATCAG
CAGATTCATCTATATATGAAGTTCTTAAATCCCATGGATTGCCAATGGGATTATTACCAAAGGGTGTGAGGAATTTCACTTTAGATAATTCTGGG
AATTTTGTGGTTCATTTAGATCAACCTTGTAATTCAAAATTTGAGAAAAAAGAAAATGAATTGCACTATGAAAGGAATGTTTCAGGGAGGTTGAG
TTTAGGTCAGATTGATTTGATTTCTGGGATTTCTGCTAAAGATTTGTTTTTGTGGTTTCAAGTTAAGAAAATTTATGTGTCATCTTCAAGTTCTG
GGGTCATTTATTTTGATGTTGGAGTTGTTTCTAAGCAGTTTTCATTGTCTTCATTTGATAATCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255357] SGN-U580044 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69083 [Download] [View] Facility Assigned ID: TBFEO01TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.905 Expected Error Rate: 0.0063 Quality Trim Threshold: 14.5