EST details — SGN-E255358

Search information 
Request: 255358Match: SGN-E255358
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34201Clone name: cLEG-30-B3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177155 is on microarray TOM1: SGN-S1-1-8.2.8.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177155 [TUS-25-N1] Trace: SGN-T181926 EST: SGN-E368973 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255358Length: 371 bp (849 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E255358 [] (trimmed) AAATGATAATTCTCGCGCGGTTCGTTACAGCATCAACCATGGTTCTCAAGACAGAACTTTGCCGTTTCAGTGGTGCCAAGATTTACCCTGGGAGA
GGCATCAGATTTATCCGGTCAGACTCTCAGGTGTTCCTATTCGTCAACTCAAAATGTAAACACTACTTCCACAACAAGTTGAAGCCATCCAAGCT
TACATGGACAGCTATGTGTAGGAAGCAACACAAGAAGGATATTGCACAAGAAGCTGCTAAGAAGAGGCGACGTACCACCAAGAAGCCTTACTCTA
GGTCTATTGTGGGTGCAACCTTGGAGGTAATCCAGAAGAAGAGAACTGAAAGGCCAGAAGTTCGAGATGCTGCCAGGGAGGCTGCT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255358] SGN-U580929 Tomato 200607 Build 2 85 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69084 [Download] [View] Facility Assigned ID: TBFEO02TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.963 Expected Error Rate: 0.0295 Quality Trim Threshold: 14.5