EST details — SGN-E255361

Search information 
Request: 255361Match: SGN-E255361
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34200Clone name: cLEG-30-B23
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177154 is on microarray TOM1: SGN-S1-1-1.1.8.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177154 [TUS-25-M24] Trace: SGN-T181857 EST: SGN-E369365 Direction: 3' Facility: INRA
Clone: SGN-C177154 [TUS-25-M24] Trace: SGN-T181858 EST: SGN-E369366 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255361Length: 542 bp (849 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255361 [] (trimmed) GCTCATTGTTGTTTATCAAGCAGATGTTAATGCAGGTCACGGGCGAGCATCACTTGGCAGTGATTGTGCGAACTCTTTGAACCCACGAGGTGGAA
GTGCAGACCTTTCCTCTGATGGATTTTTTGATGGCTGTTCCCTGCTTCACCTAGCCTGCCAAACTGCTGATATTGGCATGGTGGAGCTGCTTCTG
CAGCATGGCGCTAACATAAATGCTTGTGATTTGCGTGGTCAGATCCCACTGCATCATAGTTTCTTAAGAGGAAGAACTGAAATTGCCAAACTATT
ACTTTCAAGGGGGGCCAATCCACAAGCTGTCGATAAGGAAGGCAAGACTCCTTTCCACCTTGTCCAGGAATCAGCTCTCGATGATGTGGAGATCA
TTGCCCTGCTGAAAGTTGCCATAGGATAGCACCACAACAAAGATCAAACTGAGGTAGACAACTTAGTATTGCATCCCAGTAAAAATATTTTATCT
TCAAGAACGAAGTTTGGAGTTATACGGAAGTGCTAAAGCTTGCTCAAATCCTTAGCTTCATTCTCCC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255361] SGN-U572685 Tomato 200607 Build 2 9 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69087 [Download] [View] Facility Assigned ID: TBFEO12TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0065 Quality Trim Threshold: 14.5