EST details — SGN-E255472

Search information 
Request: 255472Match: SGN-E255472
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34209Clone name: cLEG-30-C14
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177162 is on microarray TOM1: SGN-S1-1-1.2.8.4
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177162 [TUS-25-N8] Trace: SGN-T182081 EST: SGN-E369592 Direction: 3' Facility: INRA
Clone: SGN-C177162 [TUS-25-N8] Trace: SGN-T182082 EST: SGN-E369593 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255472Length: 524 bp (877 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255472 [] (trimmed) CGAATTGGAAGTCAAGCATAATGTTATTCTGATATACTAGACTGTGGGATAAGGGGAAACATTTACACGATGCTTAATTCATAACCAACACAGCA
GAGGCATCTTCAAAGAACCTTCAGAACCATTTTGCCTGTCTTGTGAACCCCTTTAGCAGCAAGTCTAATAACAGATCGGCTCTTGTACAACCCCA
CAACTGCAAGTCCCCAAGTGGAAAGGACGTAGAACATTTGCGCGGCATGCCAAATGTTGAACAATGTTTCTACTTTACCAATGCCAAACTTATTC
GGGACGGACTACTGAGGTATTGTTATGTCTTCTAAGATTGGAAACACACGAAATAAAGAAATAATAAATGAGTGCTCACCCCACAACTGCAAGTC
CCCAAGTCGAAAGGACGTAGAACATTTGCGCGGCATGCCAAATGTTGAACAATGTTTCTACTTTACCAATGCCTTCGAATGCTTTTGCCAGGGTC
TTTTGCAGTTCTTCAGGAGACATCTTCTGAGCCTTCGAATTGGATACTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255472] SGN-U570498 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69198 [Download] [View] Facility Assigned ID: TBFEN19TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.974 Expected Error Rate: 0.0079 Quality Trim Threshold: 14.5