EST details — SGN-E255501

Search information 
Request: 255501Match: SGN-E255501
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34194Clone name: cLEG-30-B17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C177152 is on microarray TOM1: SGN-S1-1-3.1.8.12
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C177152 [TUS-25-M22] Trace: SGN-T181778 EST: SGN-E369286 Direction: 3' Facility: INRA
Clone: SGN-C177152 [TUS-25-M22] Trace: SGN-T181779 EST: SGN-E369287 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255501Length: 560 bp (840 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255501 [] (trimmed) CTCGATTTGGCTTAGCTGATCCCTTCGTATCTCGCTGTTGTTCGAAGCCATTTACTAGGATCCAAGGCCTTTTGACGTTGCTGTGCATTGGCACG
GTTATAGCGTGGCTTCTCTCTGGGCATTGGATACTGAATAATTTGCTGGGCATCTCTCTTTGTATTGCGTTTGTGAGCCATGTTCGCCTTCCTAA
CATTAAGGTTTGTGCAATGCTCCTTGGCTGCTTGTTTGTATATGATATATTCTGGGTTTTCTATTCCGAGAGATTCTTTGGTGCAAATGTCATGG
TGTCTGTAGCAACCCAGCAATCATCGAATCCTGTACACATAGTGGCGAATAGATTGAGCCTTCCTGGATTGCAGTTGATAACCAAAAAACTCGAG
TTGCCTGTCAAGATTGTGTTCCCTAGAAACTTACTGGGTGGTGTAGTGCCTGGATATGCTGCTGTTGATTTCATGATGCTGGGTCTTGGCGACAT
GGCTATTCCTTCTATGCTTTTAGCATTGGTTCTCTGTTTTGACCATAGAAAGAGCAAGGACTCTGGAAGCATCATGGATATACCA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255501] SGN-U564754 Tomato 200607 Build 2 23 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69227 [Download] [View] Facility Assigned ID: TBFEO09TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: No vector sequence detected
Passed all screens and filters
Sequence Entropy: 0.971 Expected Error Rate: 0.0018 Quality Trim Threshold: 20.5