EST details — SGN-E255510

Search information 
Request: 255510Match: SGN-E255510
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C34300Clone name: cLEG-30-H13
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180674 is on microarray TOM1: SGN-S1-1-1.4.19.11
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180674 [TUS-34-P16] Trace: SGN-T187358 EST: SGN-E375590 Direction: 3' Facility: INRA
Clone: SGN-C180674 [TUS-34-P16] Trace: SGN-T187359 EST: SGN-E375591 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E255510Length: 629 bp (847 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E255510 [] (trimmed) ATTGGTGTGGAGGTTCATCCACTTTACTTCTTCTCAAATTGTGGGAAAATTCGCGTTTATTGCTGGGATACAGCTGGACAAGAGAAGTTTGGAGG
TCTCACAGATGGTTACTAGTAAGTGATTCTAGACAGTTGAAACTTTTAGTTTCCGTGCTCTGTTGCTTGATGATAAAAACTTGTACTATCAAATC
CTTAAGAGTTAAATGTGTAAAGTTTCATGTTTCCAAAAGATGAAATATTGGTATTATGGTATGCTGGTTTGTTCTGATAATGAAGAATTATTTGA
TAACCGGTGGTGTTCTACATCAAATGTCATTATAGGTATTTCTACAATGTGGTCTCATATCTCAAGCTATAATGGCTGAGGTGACAGTAATTGTG
CTCATACCTGCGTCTCTTTTGAGCACATAATACCATAATTACCCTGCCACTCCTTTTTTTAGATCAAACACATGTTTGACTGCCTTGACATTAAT
TGTCTTGCTTGAAGCTTTCGGTGATTGTATTTTGGCTCCTCATGTTGCTCTATATCAATCGTGCGGCATTCATGGGCAATGTGCAATTATCATGT
TTGATGTTACAGCTCGTCTGACCTACAAGAATGTTCCTACTTGGCATAGAGATCTTTGC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E255510] SGN-U579056 Tomato 200607 Build 2 6 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T69236 [Download] [View] Facility Assigned ID: TBFEO43TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.957 Expected Error Rate: 0.0144 Quality Trim Threshold: 14.5