EST details — SGN-E256072

Search information 
Request: 256072Match: SGN-E256072
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36056Clone name: cLEG-37-G3
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188209 [TUS-54-J15] Trace: SGN-T351839 EST: SGN-E550964 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256072Length: 599 bp (770 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256072 [] (trimmed) GTTGAGGAGAGTTATGACAAAATGAGTGAATTAAAAGCGTTTGATGATACTAAGGCCGGTGTTAAAGGACTTGTTGATTCTGGAATTACTAAAGT
ACCTCAAATATTCGTTCTACCGCCAAAAGACAGGGCTAAAAAATGTGAAACACATTTCGTTTTTCCAGTGATAGACCTTCAAGGTATCGATGAGG
ATCCGATTAAGCATAAGGAGATAGTGGACAAAGTTCGAGATGCATCGGAGAAATGGGGTTTTTTCCAAGTGGTTAATCATGGGATTCCAACATCC
GTCTTGGACAGAACGTTGCAAGGAACACGACAGTTCTTTGAGCAAGATAACGAGCTGCAAGTTGGAGAGACACGATTTTCTGTTACATGGCTCCG
AATCCTCCCAGTCTACAAGAATTTCCAACTCCATGCGGTTTAAATTTCTAGATCCGCCACTGCTCAGTTGATTGACTATCTAAAGACAGCAAAAA
TTCCTAGATCTGTCGCTGCTCAGTTGATTGAGTATCTAAATACAGCAAATTCTTAGATCCGCCATTGCTTAGTTGATTGACTATCTAAAGACGTC
TGATTNTATATAAAAATATGTCATGTTTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256072] SGN-U577865 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70556 [Download] [View] Facility Assigned ID: TBFFO38TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0083 Quality Trim Threshold: 14.5