EST details — SGN-E256166

Search information 
Request: 256166Match: SGN-E256166
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36127Clone name: cLEG-37-K17
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C180973 is on microarray TOM1: SGN-S1-1-6.1.17.13
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C180973 [TUS-35-M3] Trace: SGN-T187425 EST: SGN-E375657 Direction: 3' Facility: INRA
Clone: SGN-C180973 [TUS-35-M3] Trace: SGN-T187426 EST: SGN-E375658 Direction: 5' Facility: INRA
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256166Length: 595 bp (779 bp untrimmed)
Status: Current VersionDirection: 5' [See links to 3' reads above]
>SGN-E256166 [] (trimmed) CCGCCTCCCACCACCGTCTAATTTGTAAATATATTCGCCGGAAACTTCTCTATCCACGCTTTCTCTATATCTATCATACCCTTTTTCTTAATTAA
TCGGTTGCTATTCCTTTGATGGCAGCGATTACGCAGAGAAAAGATTCGGATCGGATCAAAGGTCCATGGAGTCCTGAAGAGGACGAGTTGTTGCA
GACGCTTGTTGAGAAACATGGACCTAGAAACTGGACTTTGATAAGCAAATCGGTGCCGGGTCGATCTGGTAAATCCTGTCGTCTCCGGTGGTGTA
ATCAGCTTTCACCTCAAGTGGAACATCGTGCTTTTACTCCTGAAGAAGATGATACGATCATCAGGGCTCATGCCAAGTTTGGTAATAAATGGGCG
ACTATTGCCCGTTTGTTATCGGGTCGGACTGATAACGCTATAAAGAACCATTGGAACTCTACTCTTAAACGTAAGTGTCCTTCCATGTCCGAAGA
TTTAAGCTTTGAAACCCCTCAACCGCCTTTGAAAAGATCGTCTAGTGTTGGTCCCTGTACCAATTTTTCTTCTGTTATGAATCCGGGTAGTCCGT
CTGGATCCGACTTGAGTGATTCTAG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256166] SGN-U582039 Tomato 200607 Build 2 29 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70650 [Download] [View] Facility Assigned ID: TBFFO69TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.986 Expected Error Rate: 0.0015 Quality Trim Threshold: 14.5