EST details — SGN-E256220

Search information 
Request: 256220Match: SGN-E256220
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C35966Clone name: cLEG-37-B5
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: Alias clone SGN-C182396 is on microarray TOM1: SGN-S1-1-7.4.8.18
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
No additional reads found.
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256220Length: 551 bp (728 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256220 [] (trimmed) GCATTCTCCATTCTTGGAAGTGGCCATTCTTGATTTCTTGAAACAAAGTGTTTTTGTTATATACAGGGGGTGGAGTTAGAGGAAATTCAGAGTGG
CCATTGTTGAAAGAGAGGGTGGAATTTGTAAGTCAAGAAACAGGTTACTCCTGTTTGAGTGAGGAAAAGTTGGTTTGCCTGTCTGTGGTCTTTTT
ATAATCTTTTTCTACAGAAGAGAAAGTGGGTAATTTTGTTTGAGAGTGGAAATATTCTCTAGTGGGAATCTACTAGGAGTAATTTATTTTCTATA
AACTAAGTAAAGTTTGGAAGGTGACAAAAAGAAAGACAAAAATCTTGGAATTGTTTTAGACAACCAAGGTTTTCTTGCTCAGAATGTCTGTTGCC
TTGTTATGGGTTGTTTCTCCTTGTGACGTCTCAAATGGGACAAGTTTCATGGAATCAGTCCGGGAGGGAAACCGTTTTTTTGATTCATCGAGGCA
TAGGAATTTGGTGTCCAATGAGAGAATCAATAGAGGTGGTGGAAAGCAAACTAATAATGGACGGAAATTNTCTGTA
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256220] SGN-U580527 Tomato 200607 Build 2 240 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70704 [Download] [View] Facility Assigned ID: TBFFQ03TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.949 Expected Error Rate: 0.0105 Quality Trim Threshold: 14.5