EST details — SGN-E256286

Search information 
Request: 256286Match: SGN-E256286
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C36143Clone name: cLEG-37-L10
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188212 [TUS-54-J18] Trace: SGN-T351842 EST: SGN-E550967 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E256286Length: 467 bp (933 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E256286 [] (trimmed) CATGAAGGAAGAACATATTACCAGTTTGAATTAGAGCCACCACATGTGATGATCACAGCAACGGCTGCTGGAAATCGCCTATACTTGTTCAATGT
TACTGGAAATGGTCTTCAATGGAAAAGGTATTACAAAGATTTGAGAAAGATCGCTGAGTCTTTCAAGGTTGTCTGAGTTACATCTACCCCATGCG
TGATAGCACCTTAGCAGAGGTGGAATGCACAAGGTAGAAGAGTCGGTCACTATAATCACAATTATTAGAAGCCACATCACCTCTAGTAGTATATA
CAGTTAAATATGTGAGAGGAGAATTTCCTCTAGAATGAGTTTTGGTAACAAAGTTTAGCTACCAATGATTATTGTAAACTGTTTACATTACCAAT
ATTACAAGTCTTCAGAAGGCACCTCTTCTGGATTGATCGCGACATCAGGCATTGATAACTCTGTTTGATTGTCACTACAATCACCTC
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E256286] SGN-U562775 Tomato 200607 Build 2 21 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T70770 [Download] [View] Facility Assigned ID: TBFFR65TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read -- flanking 3' vector arm detected.
Passed all screens and filters
Sequence Entropy: 0.952 Expected Error Rate: 0.0065 Quality Trim Threshold: 12.5