EST details — SGN-E257046

Search information 
Request: 257046Match: SGN-E257046
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C38189Clone name: cLEG-44-M8
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188258 [TUS-54-L16] Trace: SGN-T352214 EST: SGN-E551339 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257046Length: 610 bp (823 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E257046 [] (trimmed) CAAAATGTCCTGTTTCCATATTGCTAGCTGTTGCATTGATCTGATGGTTCCATTGTTTTTTAGTAACACTTTATAGTGTACGTAGATGGCTAGTA
GGAAACGAAGCATGTCAAATGATGTAGATATGCATGTCCTGTACAAGGAATTGGATGGAGCTTCATGCCCTATATGCATGGATCATCCACACAAT
GCTGTTCTTCTCCTTTGTAGCTCTCATGATAAGGGATGCCGGTCATACATTTGTGATACAAGTTATAGGCATTCAAATTGTTTGGATCGTTTCAA
AAAACTCAAAGCCGAAAATAGGGACAATCGTCCCACTATGACACAAGGGAACCTGGATATTGCTGTTGAGATACCCGCTGAACACTTGGAGCTGA
GAAATTTAAGTGATCGTACTGTTGTTCACGGATATCACGACATACCTGCTGATGAAGTTGTAGCAACTGGTGCATTTCCTGGAGGATCAGAAGAA
AATGGAAATAGTAACAGAGATAATCGCATGGAGATGCAGGAAGGTGCTCTACAGACTTCGGATGCTGTTACTGTTTGGGGAAGTAGTCATGAAAC
AGTGAATGCAGACAACTCATCTGACTCAATATTGAAATTG
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257046] SGN-U569400 Tomato 200607 Build 2 15 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T72947 [Download] [View] Facility Assigned ID: TBFGR76TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.976 Expected Error Rate: 0.0111 Quality Trim Threshold: 14.5