EST details — SGN-E257234

Search information 
Request: 257234Match: SGN-E257234
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C38710Clone name: cLEG-46-P24
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C188301 [TUS-54-N11] Trace: SGN-T351892 EST: SGN-E551017 Direction: 5' Facility: Giovanni
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257234Length: 782 bp (867 bp untrimmed)
Status: Current VersionDirection: 5'
>SGN-E257234 [] (trimmed) CCCTGGCGTTGGACCCCAACCATTCTGCACATAATGTAAATCTTCATCTTGGTTTGTGCAAAGTCTTGGTAAAGCTTGGAAGGGGGAAGGATGCT
ATATCAAGCTGTTCAGAAGCCCTTGAACTTGATGGAGAGCTTATCGATGCTCTAGTGCAGAGGGGTGAAGCCAAGCTTCTAACAGAAGATTGGGA
GGGAGCTGTTGCAGATTTGAAAGAAGCAGCTGAAAAATCTCCTCAGGATAGGAATATTCGTGAAGTGCTGATGAGGGCTGAGAGATCATTAAAAT
TAAGTAAACGGAAGGATTGGTATAAGATATTGGGAGTGTCAAAGACATCATCTGTATCAGAGATAAAAAAGGCATACAAAAAGCTTGCGCTGCAA
TGGCACCCTGACAAGAACGTTGACAACAGAGAAGAAGCTGAAGAAAAGTTTCGTGAAATAGCAGCTGCATATGAGGTTCTCGGGGATGAGGAAAA
ACGTACACGATATGACCAAGGGGAAGACATTGAAGACATGGGTTCAGGGATGGGTGGTGGAGGATTCAACCCATTCGGTGGAGGATTTGGTGGAG
GATTTGGCGGAGGAGGGCAGCAGTACACATTCCACTTTGAAGGAGGATTTCCAGGTGGAGGCGGGGGAAGGGGGGATTTGGCGGATTTCATTTTT
GACCTCCATGGCGTTCGTTTATACTCCTCTCATGGTTGCTGCATAGCATAAAGTACAGTAGGCTCTTCTTATACTCTGATTTCCCAGAAATTTTT
GCTTTGCAGATACCATTTTTAT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257234] SGN-U563244 Tomato 200607 Build 2 7 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T73438 [Download] [View] Facility Assigned ID: TBFHB96TH
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 5' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.968 Expected Error Rate: 0.0062 Quality Trim Threshold: 14.5