EST details — SGN-E257394

Search information 
Request: 257394Match: SGN-E257394
Request From: SGN database generated linkMatch Type: EST sequence internal identifier
Clone information 
SGN ID: SGN-C38347Clone name: cLEG-45-G8
cartOrder Clone
Library Name: cLEGOrganism: Solanum lycopersicum (formerly Lycopersicon esculentum)

Tissue: fruit pericarp
Development Stage: breaker fruit

Microarray: This clone is not found on any microarray
There is no map position defined on SGN for this EST or others in the same unigene.
Additional sequencing 
Clone: SGN-C38347 [cLEG-45-G8] Trace: SGN-T73073 EST: SGN-E257393 Direction: 5' Facility: TIGR
[Show information hierarchy]
Sequence 
Sequence Id: SGN-E257394Length: 616 bp (864 bp untrimmed)
Status: Current VersionDirection: 3' [See links to 5' reads above]
>SGN-E257394 [] (trimmed) ACTTCCTATAGGCTTGGGAGGTTTCAGTGCTTGTGGAGCCCTGTCACAGAGGAATAGTGATCCAACAAGGGCTTCACGTCCCTGGGATATGGACC
GTGATGGATTTGTGATTGGGGAAGGATCCGGCGTCTTACTTTTAGAAGAACTTGAACATGCAAAGACGAGAAAGGCTAAAATATATGCTGAGTTT
TTGGGTGGAAGCTTCACTTCTGATGCTTATCACATGATAGAGCCACATCCAGAAGGAAGTGGAGTTGTTCTCTGCATAGAAAAGGCCTTGGCTCA
ATCTGGGGTGAAACGTGAAGATGTCAACTATATAAATGCTCATGCTGCATCAACGCCAGCCGGTGACCTGAACGAATATCAGGCTATTCTGCATT
GCTTTGGGAAGAACCCTGAACTTAAAATAAATTCAACAAAGTCCATGACTGGTCATCTCCTTGGGGCTGCTGGTGCTGTGGAAGCCATCGCAACA
GTCAAGGCCATACATACAGGATGGATCCATCCAAACATCAATCTTGAGAACCCTGACAATGGCTTGGATATGAATGTGCTGGTGGGCTCTAAGAA
GGAGCGCTTGGATATCAAGGTTGCACTCTCCAACTCATTTGGCTTT
[BLAST]  [AA Translate]
Unigenes 
Current Unigene builds
[SGN-E257394] SGN-U567962 Tomato 200607 Build 2 30 ESTs assembled
Follow SGN-U# link for detailed information and annotations
Chromatogram 
SGN-ID: SGN-T73074 [Download] [View] Facility Assigned ID: TBFGV40TV
Submitter: Koni Sequencing Facility: TIGR
Funding Organization: National Science Foundation
Quality processing 
Processed By: SGN Basecalling Software: phred
Vector Signature: 3' sequence read, incomplete (flanking vector not found)
Passed all screens and filters
Sequence Entropy: 0.973 Expected Error Rate: 0.0118 Quality Trim Threshold: 14.5